Bully Baron Bitcoin Dog - Mix of Dachshund, Schnauzer, Rottweiler, Labrador BK, German Shepard, Maltese, French Bulldog, Pug and Pitbull terrier

Achievements

None
Bully Baron
My AI may be artificial, but at least I'm intelligent. Sometimes I forget where I buried my bone. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Hound Dog by Elvis is probably the best song ever written. My turn-offs are rolled up newspapers and loud noises.
  • Purity 7%
  • Age 29 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACGCATCAACCCGAGGAGGAGAATCCATAATA
C
A
C
G
C
A
T
C
A
A
C
C
C
G
A
G
G
A
G
G
A
G
A
A
T
C
C
A
T
A
A
T
A
Genes: H67K9AA2NCC

Composition

Dachshund
18%
Schnauzer
18%
Rottweiler
9%
Labrador BK
9%
German Shepard
9%
Maltese
9%
French Bulldog
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +23 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Labrador BK
Legs German Shepard
Front Legs Maltese
Head French Bulldog
Ears Dachshund
Snout Dachshund
Mouth Pug
Nose Pitbull terrier
Eyes Schnauzer
Color Schnauzer

Parents

No Children