Cleopatra Chanel Crypto Game Dog - Mix of German Shepard, Boxer, St. Bernard, Schnauzer, French Bulldog, Golder Retriever, Labrador BK, Yorkshire Terrier and Border Collie

Achievements

None
Cleopatra Chanel
Yo! I'm Cleopatra Chanel and I'd like to rock your world. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. My bark alone scares birds out of my yard. The absolute best time of day is dinner time! Blue toilet water turns me off.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATCAATACGAAGAAACGCATCATTAAACTAC
T
G
A
T
C
A
A
T
A
C
G
A
A
G
A
A
A
C
G
C
A
T
C
A
T
T
A
A
A
C
T
A
C
Genes: B7C98G67FGJ

Composition

German Shepard
18%
Boxer
18%
St. Bernard
9%
Schnauzer
9%
French Bulldog
9%
Golder Retriever
9%
Labrador BK
9%
Yorkshire Terrier
9%
Border Collie
9%

Current Energy

Vitality -58 points
Lunar Effect +8 points

Traits Breakdown

Body St. Bernard
Tail German Shepard
Legs Schnauzer
Front Legs French Bulldog
Head Golder Retriever
Ears Boxer
Snout Labrador BK
Mouth German Shepard
Nose Yorkshire Terrier
Eyes Boxer
Color Border Collie