Ribbie Ram Bitcoin Dog - Mix of Shiba Inu, German Shepard, Boxer, Husky, Maltese, Pitbull terrier, Dachshund, Labrador and Rottweiler

Achievements

None
Ribbie Ram
I'm Ribbie Ram. How goes it? I am a proud show dog. I like showing off my perfect coat! My favorite place in the world is the dog park. So many smells! I'm going kill that damn Nyan Cat if I can catch it. You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACACAACCTCCGGACCAGTATCAGTATCACAC
A
A
C
A
C
A
A
C
C
T
C
C
G
G
A
C
C
A
G
T
A
T
C
A
G
T
A
T
C
A
C
A
C
Genes: G4KNA5E7E7H

Composition

Shiba Inu
18%
German Shepard
18%
Boxer
9%
Husky
9%
Maltese
9%
Pitbull terrier
9%
Dachshund
9%
Labrador
9%
Rottweiler
9%

Current Energy

Vitality -11 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Husky
Legs Maltese
Front Legs Pitbull terrier
Head Dachshund
Ears Labrador
Snout Shiba Inu
Mouth German Shepard
Nose Shiba Inu
Eyes German Shepard
Color Rottweiler

Parents

No Children