Baron Butcher Boy Digital Cryptocurrency Game Dog - Mix of Border Collie, German Shepard, Husky, Maltese, Yorkshire Terrier, Labrador BK, French Bulldog, St. Bernard and Grey Wolf

Achievements

None
Baron Butcher Boy
Hi, I'm Baron Butcher Boy. I was born in the web cloud. The place I like most in the world is curled up in my human's bed, hogging all the covers! Dragging my butt on the carpet feels so good. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Fun-loving and playful only need apply.
  • Purity 3%
  • Age 4 months
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACCTTATACTCAGCACGATCATGACCCTAC
A
C
A
A
C
C
T
T
A
T
A
C
T
C
A
G
C
A
C
G
A
T
C
A
T
G
A
C
C
C
T
A
C
Genes: 4KFJ7697BLJ

Composition

Border Collie
18%
German Shepard
18%
Husky
9%
Maltese
9%
Yorkshire Terrier
9%
Labrador BK
9%
French Bulldog
9%
St. Bernard
9%
Grey Wolf
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Maltese
Legs Yorkshire Terrier
Front Legs Border Collie
Head German Shepard
Ears Labrador BK
Snout French Bulldog
Mouth German Shepard
Nose St. Bernard
Eyes Grey Wolf
Color Border Collie