Lena Lulu Bitcoin Dog - Mix of Golder Retriever, Labrador BK, Pitbull terrier, Grey Wolf, Corgi, Poodle, Rottweiler, Shiba Inu and Maltese

Achievements

None
Lena Lulu
Lena Lulu is the name, love is my game. And fetch of course... This dawg chases mice in a big data warehouse. I am a proud show dog. I like showing off my perfect coat! I'm sick of having my nails clipped, those are to help me dig! I'll outrun you for the ball if I can...that's just how I roll.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAGAGCACCCAGCGACCACGTAACCAGAGCA
T
C
C
A
G
A
G
C
A
C
C
C
A
G
C
G
A
C
C
A
C
G
T
A
A
C
C
A
G
A
G
C
A
Genes: N86LOIHEK86

Composition

Golder Retriever
18%
Labrador BK
18%
Pitbull terrier
9%
Grey Wolf
9%
Corgi
9%
Poodle
9%
Rottweiler
9%
Shiba Inu
9%
Maltese
9%

Current Energy

Vitality -23 points
Lunar Effect -12 points

Traits Breakdown

Body Pitbull terrier
Tail Golder Retriever
Legs Labrador BK
Front Legs Grey Wolf
Head Corgi
Ears Poodle
Snout Rottweiler
Mouth Shiba Inu
Nose Maltese
Eyes Golder Retriever
Color Labrador BK