Grace Ginny Virtual Crypto Dog - Mix of Husky, Shiba Inu, Beagle, Labrador BK, Grey Wolf, Pitbull terrier, Rottweiler, Corgi, Golder Retriever and Poodle

Achievements

None
Grace Ginny
Ima Ethernet dog. I'd like to help you shed your coat, baby. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! New experiences? New treats? New places! Yes, please!
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACTAACAGCACCCTCCACACACAGCAGAGAC
G
T
A
C
T
A
A
C
A
G
C
A
C
C
C
T
C
C
A
C
A
C
A
C
A
G
C
A
G
A
G
A
C
Genes: ED46LN4HO8I

Composition

Husky
18%
Shiba Inu
9%
Beagle
9%
Labrador BK
9%
Grey Wolf
9%
Pitbull terrier
9%
Rottweiler
9%
Corgi
9%
Golder Retriever
9%
Poodle
9%

Current Energy

Vitality -23 points
Lunar Effect -2 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs Husky
Front Legs Labrador BK
Head Grey Wolf
Ears Pitbull terrier
Snout Husky
Mouth Rottweiler
Nose Corgi
Eyes Golder Retriever
Color Poodle