Phoebe Pumba Crypto Dog - Mix of Rottweiler, Grey Wolf, Pitbull terrier, Yorkshire Terrier, Corgi, Husky, Pug, Golder Retriever and Labrador

Achievements

Racer
Phoebe Pumba
I love fetching anything my human throws! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I don't like to be ignored. I'm a serial monogamist. I just want a snuggle buddy with a nice, soft coat.
  • Purity 5%
  • Age 3 months
  • Racing Exp 1
  • Rottweiler 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.88 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTTACACAGCCCCCCCACACACGAAAGACCA
T
C
C
T
T
A
C
A
C
A
G
C
C
C
C
C
C
C
A
C
A
C
A
C
G
A
A
A
G
A
C
C
A
Genes: NFHOLL4H285

Composition

Rottweiler
18%
Grey Wolf
18%
Pitbull terrier
9%
Yorkshire Terrier
9%
Corgi
9%
Husky
9%
Pug
9%
Golder Retriever
9%
Labrador
9%

Current Energy

Vitality -33 points
Lunar Effect -2 points

Traits Breakdown

Body Pitbull terrier
Tail Yorkshire Terrier
Legs Rottweiler
Front Legs Corgi
Head Grey Wolf
Ears Grey Wolf
Snout Husky
Mouth Rottweiler
Nose Pug
Eyes Golder Retriever
Color Labrador