Apollo Amaterasu Litecoin Dog - Mix of Boxer, German Shepard, Rottweiler, Husky, Dachshund, Yorkshire Terrier and Pug

Achievements

Racer
Apollo Amaterasu
You can call me Apollo Amaterasu, everybody else does. I'm into group dog piles, the more the better. I enjoy mixing it up once in a while by visiting different dog parks. I hate having to wear foo-foo clothes and ribbons in my fur. I'll be honest...Napping is my favorite so we gotta go slow.
  • Purity 8%
  • Age 3 months
  • Racing Exp 7
  • Boxer 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time16.80 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCAGGATTAAACCACACAACACACGAATCA
A
A
C
T
C
A
G
G
A
T
T
A
A
A
C
C
A
C
A
C
A
A
C
A
C
A
C
G
A
A
T
C
A
Genes: G7AFGH44H27

Composition

Boxer
18%
German Shepard
18%
Rottweiler
18%
Husky
18%
Dachshund
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality -32 points
Lunar Effect +6 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs Dachshund
Front Legs Yorkshire Terrier
Head Boxer
Ears Rottweiler
Snout Husky
Mouth Husky
Nose Rottweiler
Eyes Pug
Color German Shepard