Mandi Max Litecoin Dog - Mix of Border Collie, Grey Wolf, Beagle, Husky, Yorkshire Terrier, Schnauzer, Maltese, Poodle, Dachshund, Labrador BK and French Bulldog

Achievements

None
Mandi Max
I like nibbling on most everything, but I'll bite if you want me to. I don't like going to the groomer. Leave my beautiful fur alone! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACCCCCTAACATTAATAACCGACGGAGCACGA
T
A
C
C
C
C
C
T
A
A
C
A
T
T
A
A
T
A
A
C
C
G
A
C
G
G
A
G
C
A
C
G
A
Genes: JLD4FCKIA69

Composition

Border Collie
9%
Grey Wolf
9%
Beagle
9%
Husky
9%
Yorkshire Terrier
9%
Schnauzer
9%
Maltese
9%
Poodle
9%
Dachshund
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality -29 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Grey Wolf
Legs Beagle
Front Legs Husky
Head Yorkshire Terrier
Ears Schnauzer
Snout Maltese
Mouth Poodle
Nose Dachshund
Eyes Labrador BK
Color French Bulldog

Parents

No Children