Theodora Tabby Litecoin Dog - Mix of Labrador BK, Pitbull terrier, Beagle, Poodle, Golder Retriever, Grey Wolf, Rottweiler and St. Bernard

Achievements

Racer
Podium Champion
Theodora Tabby
I run on the information superhighway and haven't been hit by a car yet. Squeaky toys are the best, don't you agree? I like nibbling on most everything, but I'll bite if you want me to. I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 6%
  • Age 39 months
  • Racing Exp 45
  • Labrador BK 18%
  • 15 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 2 1 2
 Best Time15.23 sec
No rank  Racing *** Pts
33.3 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGCAAGAGCACCCTCCCTACTACACTCCTGA
G
A
C
G
C
A
A
G
A
G
C
A
C
C
C
T
C
C
C
T
A
C
T
A
C
A
C
T
C
C
T
G
A
Genes: I686LNDDHNB

Composition

Labrador BK
18%
Pitbull terrier
18%
Beagle
18%
Poodle
9%
Golder Retriever
9%
Grey Wolf
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Labrador BK
Legs Golder Retriever
Front Legs Labrador BK
Head Grey Wolf
Ears Pitbull terrier
Snout Beagle
Mouth Beagle
Nose Rottweiler
Eyes Pitbull terrier
Color St. Bernard