Olympia Odin Crypto Dog - Mix of Pug, Labrador BK, Golder Retriever, Dachshund, Boxer, Husky, Labrador, Grey Wolf, Rottweiler and Schnauzer

Achievements

Racer
Olympia Odin
Let me introduce myself, I'm Olympia Odin. Size doesn't matter, I like 'em all. It turns me on when I can show an older dog a new trick. Hope you like the smell of wet fur, because I'll jump into any water I see! Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff.
  • Purity 1%
  • Age 32 days
  • Racing Exp 1
  • Pug 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time18.40 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAAGAGGAGAAAACACAGAACCACCCCACATA
G
C
A
A
G
A
G
G
A
G
A
A
A
A
C
A
C
A
G
A
A
C
C
A
C
C
C
C
A
C
A
T
A
Genes: 68A2G425LHC

Composition

Pug
18%
Labrador BK
9%
Golder Retriever
9%
Dachshund
9%
Boxer
9%
Husky
9%
Labrador
9%
Grey Wolf
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality +6 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Dachshund
Front Legs Pug
Head Boxer
Ears Husky
Snout Pug
Mouth Labrador
Nose Grey Wolf
Eyes Rottweiler
Color Schnauzer

Parents

No Children

Photos