Quinn Quark Bitcoin Game Dog - Mix of Labrador BK, Schnauzer, Labrador, Rottweiler, Corgi, Poodle, Grey Wolf and Border Collie

Achievements

None
Quinn Quark
Currently, I live on the information superhighway. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGCAATAAGCGACATACCCCCACCAGCATAC
C
A
C
G
C
A
A
T
A
A
G
C
G
A
C
A
T
A
C
C
C
C
C
A
C
C
A
G
C
A
T
A
C
Genes: H6COICL556J

Composition

Labrador BK
18%
Schnauzer
18%
Labrador
18%
Rottweiler
9%
Corgi
9%
Poodle
9%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -37 points
Lunar Effect -2 points

Traits Breakdown

Body Rottweiler
Tail Labrador BK
Legs Schnauzer
Front Legs Corgi
Head Poodle
Ears Schnauzer
Snout Grey Wolf
Mouth Labrador
Nose Labrador
Eyes Labrador BK
Color Border Collie