Sunny Salem Crypto Dog - Mix of Beagle, Labrador BK, Boxer, Rottweiler, Border Collie, Labrador, French Bulldog and Yorkshire Terrier

Achievements

None
Sunny Salem
How goes it? I'm Sunny Salem. Shy dogs that tuck tail bore me. I never knew my father. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.
  • Purity 6%
  • Age 31 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCTATACGCACCACTAAACAACCGAGCATTA
C
A
C
C
T
A
T
A
C
G
C
A
C
C
A
C
T
A
A
A
C
A
A
C
C
G
A
G
C
A
T
T
A
Genes: HDJ65DGG96F

Composition

Beagle
18%
Labrador BK
18%
Boxer
18%
Rottweiler
9%
Border Collie
9%
Labrador
9%
French Bulldog
9%
Yorkshire Terrier
9%

Current Energy

Vitality +41 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Beagle
Legs Border Collie
Front Legs Labrador BK
Head Labrador
Ears Beagle
Snout Boxer
Mouth Boxer
Nose French Bulldog
Eyes Labrador BK
Color Yorkshire Terrier

Parents

No Children