Bosco Brian Griffin Bitcoin Dog - Mix of French Bulldog, St. Bernard, Poodle, Grey Wolf, Corgi, Border Collie, Yorkshire Terrier, Dachshund and Husky

Achievements

None
Bosco Brian Griffin
I'm Bosco Brian Griffin and I'd like to show you a trick or two. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! Blue toilet water turns me off. You scratch my belly and I'll scratch yours ;)
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACCGATGACCCAGCTACCGATGATTAGGAACA
G
A
C
C
G
A
T
G
A
C
C
C
A
G
C
T
A
C
C
G
A
T
G
A
T
T
A
G
G
A
A
C
A
Genes: I9BLOJ9BFA4

Composition

French Bulldog
18%
St. Bernard
18%
Poodle
9%
Grey Wolf
9%
Corgi
9%
Border Collie
9%
Yorkshire Terrier
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality +27 points
Lunar Effect -12 points

Traits Breakdown

Body Poodle
Tail French Bulldog
Legs St. Bernard
Front Legs Grey Wolf
Head Corgi
Ears Border Collie
Snout French Bulldog
Mouth St. Bernard
Nose Yorkshire Terrier
Eyes Dachshund
Color Husky