Bayleaf Bridgette Digital Cryptocurrency Game Dog - Mix of St. Bernard, Schnauzer, German Shepard, Beagle, Golder Retriever, Labrador BK and Pitbull terrier

Achievements

None
Bayleaf Bridgette
The internet's my home. I enjoy staying active, and running circles around puppies and young children. Sometimes I forget where I buried my bone. In my humble opinion the best toy is one of my human's stinky, old socks. My humans should try spending 8 hours a day in a crate!
  • Purity 12%
  • Age 30 days
  • Racing Exp 0
  • St. Bernard 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAATACTATGAATAAGATGATGAGCATGATCC
T
C
A
A
T
A
C
T
A
T
G
A
A
T
A
A
G
A
T
G
A
T
G
A
G
C
A
T
G
A
T
C
C
Genes: 7CDBC8BB6BN

Composition

St. Bernard
36%
Schnauzer
18%
German Shepard
9%
Beagle
9%
Golder Retriever
9%
Labrador BK
9%
Pitbull terrier
9%

Current Energy

Vitality +25 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Schnauzer
Legs Beagle
Front Legs St. Bernard
Head Schnauzer
Ears Golder Retriever
Snout St. Bernard
Mouth St. Bernard
Nose Labrador BK
Eyes St. Bernard
Color Pitbull terrier

Parents

No Children