Argos Ajax Cryptocurrency Dog - Mix of Corgi, Yorkshire Terrier, Schnauzer, Poodle, Boxer, Labrador, Beagle, Dachshund and Maltese

Achievements

None
Argos Ajax
In the big data server, I sorta rule. Spiked dog collars really turn me on. Steak is my absolute favorite, but I prefer to eat chicken for my health. I don't like running outta pee when there are still so many trees. I'm looking to share time together and not just to be an accessory.
  • Purity 5%
  • Age 32 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATAAGCAGCGACTTAAACCCATTACTAGGAACC
A
T
A
A
G
C
A
G
C
G
A
C
T
T
A
A
A
C
C
C
A
T
T
A
C
T
A
G
G
A
A
C
C
Genes: COOIFG5FDAK

Composition

Corgi
18%
Yorkshire Terrier
18%
Schnauzer
9%
Poodle
9%
Boxer
9%
Labrador
9%
Beagle
9%
Dachshund
9%
Maltese
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Corgi
Legs Corgi
Front Legs Poodle
Head Yorkshire Terrier
Ears Boxer
Snout Labrador
Mouth Yorkshire Terrier
Nose Beagle
Eyes Dachshund
Color Maltese

Parents

No Children