Bail Beemer Bitcoin Dog - Mix of Yorkshire Terrier, Husky, Border Collie, Rottweiler, St. Bernard, Poodle and Shiba Inu

Achievements

None
Bail Beemer
Well hello, beautiful. My name's Bail Beemer. People food disagrees with me. Whew! You can tell. I hate bubble baths; mud puddles are more my style. Forget plastic hotdogs...I'm into the classic chew toys like slippers. Slipping my collar, running off and making my humans worried? Every chance I get.
  • Purity 9%
  • Age 32 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATTAACATACTACACATGACACGACCACGTA
T
T
A
T
T
A
A
C
A
T
A
C
T
A
C
A
C
A
T
G
A
C
A
C
G
A
C
C
A
C
G
T
A
Genes: FF4JJ4BHIHE

Composition

Yorkshire Terrier
18%
Husky
18%
Border Collie
18%
Rottweiler
18%
St. Bernard
9%
Poodle
9%
Shiba Inu
9%

Current Energy

Vitality +45 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Yorkshire Terrier
Legs Husky
Front Legs Border Collie
Head Border Collie
Ears Husky
Snout St. Bernard
Mouth Rottweiler
Nose Poodle
Eyes Rottweiler
Color Shiba Inu

Parents

No Children