Roxy Roxie Bitcoin Dog - Mix of Pug, Shiba Inu, Labrador BK, French Bulldog, Golder Retriever and German Shepard

Achievements

None
Roxy Roxie
Well hello, beautiful. My name's Roxy Roxie. People food disagrees with me. Whew! You can tell. I hate bubble baths; mud puddles are more my style. Forget plastic hotdogs...I'm into the classic chew toys like slippers. Slipping my collar, running off and making my humans worried? Every chance I get.
  • Purity 17%
  • Age 59 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGTAGCAGAACGAGTAGTAGAAAGATCA
G
A
A
G
A
A
G
T
A
G
C
A
G
A
A
C
G
A
G
T
A
G
T
A
G
A
A
A
G
A
T
C
A
Genes: 22E629EE287

Composition

Pug
36%
Shiba Inu
27%
Labrador BK
9%
French Bulldog
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -13 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Shiba Inu
Front Legs Labrador BK
Head Pug
Ears French Bulldog
Snout Shiba Inu
Mouth Shiba Inu
Nose Pug
Eyes Golder Retriever
Color German Shepard