Woofie Winnie the Poodle Litecoin Dog - Mix of Corgi, Schnauzer, Poodle, Pitbull terrier, Beagle, Boxer and French Bulldog
Woofie Winnie the Poodle
  • Purity 18%
  • Age 37 months
  • Racing Exp 13
  • Corgi 45%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Greetings. My name is Woofie Winnie the Poodle. I run on the information superhighway and haven't been hit by a car yet. People food disagrees with me. Whew! You can tell. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!

Racing Stats

Ran 2 races
  • 0 1 1
 Best Time16.85 sec
No rank  RacingĀ *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAAGCGACTCCCTAAGCAACAGCAGCAGCCGA
A
T
A
A
G
C
G
A
C
T
C
C
C
T
A
A
G
C
A
A
C
A
G
C
A
G
C
A
G
C
C
G
A
Genes: COINDOGOOO9

Composition

Corgi
45%
Schnauzer
9%
Poodle
9%
Pitbull terrier
9%
Beagle
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Corgi
Legs Poodle
Front Legs Pitbull terrier
Head Beagle
Ears Corgi
Snout Boxer
Mouth Corgi
Nose Corgi
Eyes Corgi
Color French Bulldog

Parents

No Children

Photos

crypto pet racing photo virtual doggy race photo Litecoin canine race podium Bitcoin dog race Litecoin pet racing podium crypto doggy race
Gift