Shell Sebastian Virtual Crypto Dog - Mix of Pug, Golder Retriever, Rottweiler, Labrador and Corgi

Achievements

None
Shell Sebastian
Sup? ;-) I'm Shell Sebastian. I'm not a bad dog, my data is just configured that way. My favorite thing is to sit in my humans' laps while they are trying to read or drive. It doesn't matter to me which team I play for... I just like tail. I'm looking for some ruff play. Wanna bite me?
  • Purity 21%
  • Age 59 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 9
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAAGACACGAAAGAAGACCAGAAAGAAGC
G
A
A
G
A
A
A
G
A
C
A
C
G
A
A
A
G
A
A
G
A
C
C
A
G
A
A
A
G
A
A
G
C
Genes: 228H288528O

Composition

Pug
36%
Golder Retriever
36%
Rottweiler
9%
Labrador
9%
Corgi
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Golder Retriever
Front Legs Rottweiler
Head Pug
Ears Golder Retriever
Snout Golder Retriever
Mouth Labrador
Nose Pug
Eyes Golder Retriever
Color Corgi