George Giga Virtual Crypto Dog - Mix of Yorkshire Terrier, Shiba Inu, Pitbull terrier, Rottweiler, Pug, Golder Retriever, Husky, Boxer and Grey Wolf

Achievements

None
George Giga
Sup? ;-) I'm George Giga. I'm not a bad dog, my data is just configured that way. My favorite thing is to sit in my humans' laps while they are trying to read or drive. It doesn't matter to me which team I play for... I just like tail. I'm looking for some ruff play. Wanna bite me?
  • Purity 3%
  • Age 32 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATCCCACGAAGTAAGAACAAACTTAGTACCC
T
T
A
T
C
C
C
A
C
G
A
A
G
T
A
A
G
A
A
C
A
A
A
C
T
T
A
G
T
A
C
C
C
Genes: FNH2E84GFEL

Composition

Yorkshire Terrier
18%
Shiba Inu
18%
Pitbull terrier
9%
Rottweiler
9%
Pug
9%
Golder Retriever
9%
Husky
9%
Boxer
9%
Grey Wolf
9%

Current Energy

Vitality +11 points
Lunar Effect -8 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pitbull terrier
Legs Rottweiler
Front Legs Pug
Head Shiba Inu
Ears Golder Retriever
Snout Husky
Mouth Boxer
Nose Yorkshire Terrier
Eyes Shiba Inu
Color Grey Wolf

Parents

No Children