Lynx Laika Litecoin Dog - Mix of German Shepard, Pitbull terrier, Border Collie, Pug and Poodle

Achievements

None
Lynx Laika
Hi, I'm Lynx Laika. I never met a leg I didn't want to hump. I hate bubble baths; mud puddles are more my style. My favorite song is "Who Let the Dogs Out?" It was me :) Forget plastic hotdogs...I'm into the classic chew toys like slippers. Just looking to sow some wild oats here...
  • Purity 29%
  • Age 14 months
  • Racing Exp 0
  • German Shepard 55%
  • 0 races
  • Gen 21
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAATCATCATCATCCTCATCATCCGACTCA
T
A
C
G
A
A
T
C
A
T
C
A
T
C
A
T
C
C
T
C
A
T
C
A
T
C
C
G
A
C
T
C
A
Genes: J2777N77NI7

Composition

German Shepard
55%
Pitbull terrier
18%
Border Collie
9%
Pug
9%
Poodle
9%

Current Energy

Vitality -6 points
Lunar Effect +10 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Pitbull terrier
Snout German Shepard
Mouth German Shepard
Nose Pitbull terrier
Eyes Poodle
Color German Shepard