Taco Tiger Lilly Litecoin Dog - Mix of Pug, Rottweiler, Dachshund, Shiba Inu, Corgi, Maltese, Schnauzer, Boxer, French Bulldog and Golder Retriever

Achievements

None
Taco Tiger Lilly
Hi, I'm Taco Tiger Lilly. I never met a leg I didn't want to hump. I hate bubble baths; mud puddles are more my style. My favorite song is "Who Let the Dogs Out?" It was me :) Forget plastic hotdogs...I'm into the classic chew toys like slippers. Just looking to sow some wild oats here...
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACGGAGTAGAAAGCACCATAAACCGAAGAGAA
C
A
C
G
G
A
G
T
A
G
A
A
A
G
C
A
C
C
A
T
A
A
A
C
C
G
A
A
G
A
G
A
A
Genes: HAE2OKCG982

Composition

Pug
18%
Rottweiler
9%
Dachshund
9%
Shiba Inu
9%
Corgi
9%
Maltese
9%
Schnauzer
9%
Boxer
9%
French Bulldog
9%
Golder Retriever
9%

Current Energy

Vitality -1 points
Lunar Effect -2 points

Traits Breakdown

Body Rottweiler
Tail Dachshund
Legs Shiba Inu
Front Legs Pug
Head Corgi
Ears Maltese
Snout Schnauzer
Mouth Boxer
Nose French Bulldog
Eyes Golder Retriever
Color Pug

Parents

No Children