Katz Kasumi Litecoin Game Dog - Mix of Labrador, French Bulldog, Corgi, Husky, Pug, Boxer and Shiba Inu

Achievements

None
Katz Kasumi
Hola! My name is Katz Kasumi. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I really enjoy heavy petting. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan.
  • Purity 7%
  • Age 2 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 9
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACGACCACGACCAGAAAGCAACAGCGTACCA
A
C
A
C
G
A
C
C
A
C
G
A
C
C
A
G
A
A
A
G
C
A
A
C
A
G
C
G
T
A
C
C
A
Genes: 495952OGOE5

Composition

Labrador
27%
French Bulldog
18%
Corgi
18%
Husky
9%
Pug
9%
Boxer
9%
Shiba Inu
9%

Current Energy

Vitality -12 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Labrador
Front Legs French Bulldog
Head Labrador
Ears Pug
Snout Corgi
Mouth Boxer
Nose Corgi
Eyes Shiba Inu
Color Labrador