Zoey Zinger Litecoin Game Dog - Mix of French Bulldog, Labrador, Pug, German Shepard, Shiba Inu, Schnauzer, Husky and Maltese

Achievements

None
Zoey Zinger
Hola! My name is Zoey Zinger. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I really enjoy heavy petting. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan.
  • Purity 6%
  • Age 31 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAATCACGAGTAATACGAACACCAACCCCACGA
G
A
A
T
C
A
C
G
A
G
T
A
A
T
A
C
G
A
A
C
A
C
C
A
A
C
C
C
C
A
C
G
A
Genes: 279EC945K59

Composition

French Bulldog
27%
Labrador
18%
Pug
9%
German Shepard
9%
Shiba Inu
9%
Schnauzer
9%
Husky
9%
Maltese
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail German Shepard
Legs French Bulldog
Front Legs Shiba Inu
Head Schnauzer
Ears French Bulldog
Snout Husky
Mouth Labrador
Nose Maltese
Eyes Labrador
Color French Bulldog

Parents

No Children