Tito Toots Digital Cryptocurrency Dog - Mix of Rottweiler, Border Collie, Golder Retriever, Yorkshire Terrier, Labrador, Beagle, St. Bernard, Schnauzer, Husky, Maltese and Corgi

Achievements

None
Tito Toots
My favorite position is doggie style ;) I enjoy staying active, and running circles around puppies and young children. I slept with a cat and I liked it. Power outages and computer viruses scare me!
  • Purity 0%
  • Age 31 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTACAGATTACCACTATGAATAACAACCAGC
C
A
C
T
A
C
A
G
A
T
T
A
C
C
A
C
T
A
T
G
A
A
T
A
A
C
A
A
C
C
A
G
C
Genes: HJ8F5DBC4KO

Composition

Rottweiler
9%
Border Collie
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Labrador
9%
Beagle
9%
St. Bernard
9%
Schnauzer
9%
Husky
9%
Maltese
9%
Corgi
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Border Collie
Legs Golder Retriever
Front Legs Yorkshire Terrier
Head Labrador
Ears Beagle
Snout St. Bernard
Mouth Schnauzer
Nose Husky
Eyes Maltese
Color Corgi

Parents

No Children