Goofy Gunner Digital Cryptocurrency Dog - Pure German Shepard

Achievements

None
Goofy Gunner
My favorite position is doggie style ;) I enjoy staying active, and running circles around puppies and young children. I slept with a cat and I liked it. Power outages and computer viruses scare me!
  • Purity 100%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 100%
  • 0 races
  • Gen 21
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCATCA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 77777777777

Composition

German Shepard
100%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Traits 100% Purebred German Shepard