Charlotte Cameo Bitcoin Game Dog - Mix of Rottweiler, St. Bernard, Labrador, Yorkshire Terrier, Border Collie, Schnauzer, Pug, Shiba Inu, Beagle and Dachshund

Achievements

Racer
Charlotte Cameo
Salutations! My name's Charlotte Cameo. I hate it when my humans fart and they blame me! I slept with a cat and I liked it. The absolute best time of day is dinner time! I like giving wet kisses.
  • Purity 1%
  • Age 39 months
  • Racing Exp 1
  • Rottweiler 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.60 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTGACCACACTTATACATAGAAGTACTAGGA
C
A
C
T
G
A
C
C
A
C
A
C
T
T
A
T
A
C
A
T
A
G
A
A
G
T
A
C
T
A
G
G
A
Genes: HB5HFJC2EDA

Composition

Rottweiler
18%
St. Bernard
9%
Labrador
9%
Yorkshire Terrier
9%
Border Collie
9%
Schnauzer
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Labrador
Front Legs Rottweiler
Head Yorkshire Terrier
Ears Border Collie
Snout Schnauzer
Mouth Pug
Nose Shiba Inu
Eyes Beagle
Color Dachshund

Parents

No Children

Photos