Charlotte Cameo Bitcoin Game Dog - Mix of Rottweiler, St. Bernard, Labrador, Yorkshire Terrier, Border Collie, Schnauzer, Pug, Shiba Inu, Beagle and Dachshund

Achievements

None
Charlotte Cameo
Salutations! My name's Charlotte Cameo. I hate it when my humans fart and they blame me! I slept with a cat and I liked it. The absolute best time of day is dinner time! I like giving wet kisses.
  • Purity 1%
  • Age 42 months
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGACCACACTTATACATAGAAGTACTAGGA
C
A
C
T
G
A
C
C
A
C
A
C
T
T
A
T
A
C
A
T
A
G
A
A
G
T
A
C
T
A
G
G
A
Genes: HB5HFJC2EDA

Composition

Rottweiler
18%
St. Bernard
9%
Labrador
9%
Yorkshire Terrier
9%
Border Collie
9%
Schnauzer
9%
Pug
9%
Shiba Inu
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Labrador
Front Legs Rottweiler
Head Yorkshire Terrier
Ears Border Collie
Snout Schnauzer
Mouth Pug
Nose Shiba Inu
Eyes Beagle
Color Dachshund