Harpo Hank Bitcoin Dog - Mix of Labrador, Labrador BK, Border Collie, Rottweiler, Dachshund, Boxer and Maltese

Achievements

None
Harpo Hank
Hey! My name's Harpo Hank! Squeaky toys are the best, don't you agree? I really enjoy heavy petting. I don't understand why I like smelling butts... I really dislike stinky flea collars.
  • Purity 7%
  • Age 5 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACCATACGCACACGGATACCCAAACCCAACC
G
C
A
C
C
A
T
A
C
G
C
A
C
A
C
G
G
A
T
A
C
C
C
A
A
A
C
C
C
A
A
C
C
Genes: 65J6HAJ5G5K

Composition

Labrador
27%
Labrador BK
18%
Border Collie
18%
Rottweiler
9%
Dachshund
9%
Boxer
9%
Maltese
9%

Current Energy

Vitality +1 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador BK
Tail Labrador
Legs Border Collie
Front Legs Labrador BK
Head Rottweiler
Ears Dachshund
Snout Border Collie
Mouth Labrador
Nose Boxer
Eyes Labrador
Color Maltese