Tyrion Tails Bitcoin Dog - Mix of Border Collie, St. Bernard, Golder Retriever, Dachshund, Maltese, Pitbull terrier and Beagle

Achievements

None
Tyrion Tails
Hey! My name's Tyrion Tails! Squeaky toys are the best, don't you agree? I really enjoy heavy petting. I don't understand why I like smelling butts... I really dislike stinky flea collars.
  • Purity 12%
  • Age 31 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGATACGGATGATGAACCTACTACTGATCCCTA
A
G
A
T
A
C
G
G
A
T
G
A
T
G
A
A
C
C
T
A
C
T
A
C
T
G
A
T
C
C
C
T
A
Genes: 8JABBKJJBND

Composition

Border Collie
27%
St. Bernard
27%
Golder Retriever
9%
Dachshund
9%
Maltese
9%
Pitbull terrier
9%
Beagle
9%

Current Energy

Vitality +25 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Dachshund
Front Legs St. Bernard
Head St. Bernard
Ears Maltese
Snout Border Collie
Mouth Border Collie
Nose St. Bernard
Eyes Pitbull terrier
Color Beagle

Parents

No Children