Ivan Iris Crypto Game Dog - Mix of Dachshund, Golder Retriever, Labrador BK, Boxer, German Shepard, Maltese, Pitbull terrier, Shiba Inu, Labrador, Pug and Border Collie

Achievements

None
Ivan Iris
I am not above stealing food off humans' plates. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Rolling around on the carpet after a bath is my favorite way to dry. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 0%
  • Age 41 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAAGAGCAAACTCAACCTCCGTACCAGAATAC
G
G
A
A
G
A
G
C
A
A
A
C
T
C
A
A
C
C
T
C
C
G
T
A
C
C
A
G
A
A
T
A
C
Genes: A86G7KNE52J

Composition

Dachshund
9%
Golder Retriever
9%
Labrador BK
9%
Boxer
9%
German Shepard
9%
Maltese
9%
Pitbull terrier
9%
Shiba Inu
9%
Labrador
9%
Pug
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Golder Retriever
Legs Labrador BK
Front Legs Boxer
Head German Shepard
Ears Maltese
Snout Pitbull terrier
Mouth Shiba Inu
Nose Labrador
Eyes Pug
Color Border Collie