Legolas Linx Bitcoin Dog - Mix of Corgi, German Shepard, Grey Wolf, Border Collie, Labrador BK, Dachshund, St. Bernard and Poodle

Achievements

None
Legolas Linx
As a good digital dog, my humans give me virtually everything. In my humble opinion the best toy is one of my human's stinky, old socks. Watching kids play without me is the worst, no? It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 4%
  • Age 33 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGCAGGATGAGACAGCTCACCCTCACCCAGC
T
A
C
G
C
A
G
G
A
T
G
A
G
A
C
A
G
C
T
C
A
C
C
C
T
C
A
C
C
C
A
G
C
Genes: J6ABIO7L7LO

Composition

Corgi
18%
German Shepard
18%
Grey Wolf
18%
Border Collie
9%
Labrador BK
9%
Dachshund
9%
St. Bernard
9%
Poodle
9%

Current Energy

Vitality +4 points
Lunar Effect -10 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Dachshund
Front Legs St. Bernard
Head Poodle
Ears Corgi
Snout German Shepard
Mouth Grey Wolf
Nose German Shepard
Eyes Grey Wolf
Color Corgi

Parents

No Children