Diddy Kong Daffy Crypto Dog - Mix of Yorkshire Terrier, Pitbull terrier, Boxer, Labrador BK, Husky, French Bulldog, Rottweiler, Labrador and Border Collie

Achievements

Racer
Diddy Kong Daffy
Hey there... I'm Diddy Kong Daffy. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. Creativity is my middle name... I turn everything in to a chew toy. I'm not into dog collars, unless you're into S & M. Fun-loving and playful only need apply.
  • Purity 3%
  • Age 39 months
  • Racing Exp 8
  • Yorkshire Terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 1 0 0
 Best Time16.67 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAAACGCAACATCCCGACACTTACCATCCTAC
T
T
A
A
A
C
G
C
A
A
C
A
T
C
C
C
G
A
C
A
C
T
T
A
C
C
A
T
C
C
T
A
C
Genes: FG64N9HF5NJ

Composition

Yorkshire Terrier
18%
Pitbull terrier
18%
Boxer
9%
Labrador BK
9%
Husky
9%
French Bulldog
9%
Rottweiler
9%
Labrador
9%
Border Collie
9%

Current Energy

Vitality -34 points
Lunar Effect +6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Boxer
Legs Labrador BK
Front Legs Husky
Head Pitbull terrier
Ears French Bulldog
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Labrador
Eyes Pitbull terrier
Color Border Collie

Parents

Children

Photos

online canine racing