Miss Kitty Minnie Cryptocurrency Dog - Mix of Yorkshire Terrier, Poodle, Boxer, Border Collie, Husky, Golder Retriever, Pug, St. Bernard, Rottweiler and Dachshund

Achievements

None
Miss Kitty Minnie
I've been known to take mega bytes when playing ruff. I could spend days on end chasing my tail. I get so close but it's just so fast! I hate it when humans put the lid down. My bark alone scares birds out of my yard. I don't understand why I like smelling butts...
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACAACTACTTAACAAGATTAGAATGACACGGA
G
A
C
A
A
C
T
A
C
T
T
A
A
C
A
A
G
A
T
T
A
G
A
A
T
G
A
C
A
C
G
G
A
Genes: IGJF48F2BHA

Composition

Yorkshire Terrier
18%
Poodle
9%
Boxer
9%
Border Collie
9%
Husky
9%
Golder Retriever
9%
Pug
9%
St. Bernard
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -25 points
Lunar Effect +4 points

Traits Breakdown

Body Poodle
Tail Boxer
Legs Border Collie
Front Legs Yorkshire Terrier
Head Husky
Ears Golder Retriever
Snout Yorkshire Terrier
Mouth Pug
Nose St. Bernard
Eyes Rottweiler
Color Dachshund