Curly Christie Cryptocurrency Dog - Mix of Labrador, Rottweiler, German Shepard, Poodle, Pug, Maltese, Yorkshire Terrier and French Bulldog

Achievements

None
Curly Christie
I've been known to take mega bytes when playing ruff. I could spend days on end chasing my tail. I get so close but it's just so fast! I hate it when humans put the lid down. My bark alone scares birds out of my yard. I don't understand why I like smelling butts...
  • Purity 6%
  • Age 33 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGACCCAGAACACACCTTATCATCACACCGA
C
C
A
G
A
C
C
C
A
G
A
A
C
A
C
A
C
C
T
T
A
T
C
A
T
C
A
C
A
C
C
G
A
Genes: 5I52HKF77H9

Composition

Labrador
18%
Rottweiler
18%
German Shepard
18%
Poodle
9%
Pug
9%
Maltese
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality +28 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Poodle
Legs Labrador
Front Legs Pug
Head Rottweiler
Ears Maltese
Snout Yorkshire Terrier
Mouth German Shepard
Nose German Shepard
Eyes Rottweiler
Color French Bulldog