Dana Darth Bitcoin Dog - Mix of Dachshund, St. Bernard, Labrador BK, German Shepard, Shiba Inu, Border Collie, Pitbull terrier, Rottweiler and Golder Retriever

Achievements

None
Dana Darth
Dana Darth is the name, love is my game. And fetch of course... Halloween costumes are the worst, I hate 'em! I like never worrying about my dog poo. I've got people for that. I'll lick anything. I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGCAGGATGATCAGTATACTGATCCCACAGA
G
G
A
G
C
A
G
G
A
T
G
A
T
C
A
G
T
A
T
A
C
T
G
A
T
C
C
C
A
C
A
G
A
Genes: A6AB7EJBNH8

Composition

Dachshund
18%
St. Bernard
18%
Labrador BK
9%
German Shepard
9%
Shiba Inu
9%
Border Collie
9%
Pitbull terrier
9%
Rottweiler
9%
Golder Retriever
9%

Current Energy

Vitality +26 points
Lunar Effect +12 points

Traits Breakdown

Body Dachshund
Tail Labrador BK
Legs Dachshund
Front Legs St. Bernard
Head German Shepard
Ears Shiba Inu
Snout Border Collie
Mouth St. Bernard
Nose Pitbull terrier
Eyes Rottweiler
Color Golder Retriever

Parents

No Children