Kasumi Kong Bitcoin Dog - Mix of Shiba Inu, Yorkshire Terrier, Border Collie, Schnauzer, St. Bernard, Golder Retriever, Pug and Corgi

Achievements

None
Kasumi Kong
Kasumi Kong is the name, love is my game. And fetch of course... Halloween costumes are the worst, I hate 'em! I like never worrying about my dog poo. I've got people for that. I'll lick anything. I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 6%
  • Age 15 months
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAATATGATTATACAGAGAAAGCTACTTAGTA
G
T
A
A
T
A
T
G
A
T
T
A
T
A
C
A
G
A
G
A
A
A
G
C
T
A
C
T
T
A
G
T
A
Genes: ECBFJ82OJFE

Composition

Shiba Inu
18%
Yorkshire Terrier
18%
Border Collie
18%
Schnauzer
9%
St. Bernard
9%
Golder Retriever
9%
Pug
9%
Corgi
9%

Current Energy

Vitality -32 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Schnauzer
Legs St. Bernard
Front Legs Yorkshire Terrier
Head Border Collie
Ears Golder Retriever
Snout Pug
Mouth Corgi
Nose Border Collie
Eyes Yorkshire Terrier
Color Shiba Inu