Scooter Samantha Bitcoin Game Dog - Mix of Corgi, German Shepard, Dachshund, Labrador, St. Bernard, Pug, Beagle, Maltese and Pitbull terrier

Achievements

None
Scooter Samantha
Who's a good dog? Hopefully you! Scooter Samantha here. I am a proud show dog. I like showing off my perfect coat! I cry whenever I hear an ambulance siren! I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! Fun-loving and playful only need apply.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCGGACCATGAGAACTAACCTCCTCAAGCTCA
A
G
C
G
G
A
C
C
A
T
G
A
G
A
A
C
T
A
A
C
C
T
C
C
T
C
A
A
G
C
T
C
A
Genes: OA5B2DKN7O7

Composition

Corgi
18%
German Shepard
18%
Dachshund
9%
Labrador
9%
St. Bernard
9%
Pug
9%
Beagle
9%
Maltese
9%
Pitbull terrier
9%

Current Energy

Vitality +16 points
Lunar Effect -6 points

Traits Breakdown

Body Corgi
Tail Dachshund
Legs Labrador
Front Legs St. Bernard
Head Pug
Ears Beagle
Snout Maltese
Mouth Pitbull terrier
Nose German Shepard
Eyes Corgi
Color German Shepard

Parents

No Children