Ursula Uber Bitcoin Game Dog - Mix of Labrador, Border Collie, Husky, Yorkshire Terrier, German Shepard, Dachshund, French Bulldog and Maltese

Achievements

None
Ursula Uber
Who's a good dog? Hopefully you! Ursula Uber here. I am a proud show dog. I like showing off my perfect coat! I cry whenever I hear an ambulance siren! I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! Fun-loving and playful only need apply.
  • Purity 4%
  • Age 3 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACCATACACATCAACATACGGACGACCAACC
T
T
A
C
C
A
T
A
C
A
C
A
T
C
A
A
C
A
T
A
C
G
G
A
C
G
A
C
C
A
A
C
C
Genes: F5J474JA95K

Composition

Labrador
18%
Border Collie
18%
Husky
18%
Yorkshire Terrier
9%
German Shepard
9%
Dachshund
9%
French Bulldog
9%
Maltese
9%

Current Energy

Vitality -13 points
Lunar Effect +2 points

Traits Breakdown

Body Yorkshire Terrier
Tail Labrador
Legs Border Collie
Front Legs Husky
Head German Shepard
Ears Husky
Snout Border Collie
Mouth Dachshund
Nose French Bulldog
Eyes Labrador
Color Maltese