Fuzzball Freeway Digital Cryptocurrency Dog - Mix of German Shepard, Labrador, Border Collie, Dachshund, Labrador BK, French Bulldog, Maltese, Pug, Rottweiler, Husky and Schnauzer

Achievements

None
Fuzzball Freeway
Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I hate hiding under the bed during a thunder storm but that's just smart, right? I need laid otherwise I'm going to start agreeing with Grumpy Cat. I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACCATACGGAGCACGAACCGAACACACAATA
T
C
A
C
C
A
T
A
C
G
G
A
G
C
A
C
G
A
A
C
C
G
A
A
C
A
C
A
C
A
A
T
A
Genes: 75JA69K2H4C

Composition

German Shepard
9%
Labrador
9%
Border Collie
9%
Dachshund
9%
Labrador BK
9%
French Bulldog
9%
Maltese
9%
Pug
9%
Rottweiler
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality -24 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Labrador
Legs Border Collie
Front Legs Dachshund
Head Labrador BK
Ears French Bulldog
Snout Maltese
Mouth Pug
Nose Rottweiler
Eyes Husky
Color Schnauzer