Rolex Ref Digital Cryptocurrency Dog - Mix of Beagle, St. Bernard, Golder Retriever, Labrador BK, German Shepard, Boxer, Labrador, Dachshund and Pug

Achievements

None
Rolex Ref
Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I hate hiding under the bed during a thunder storm but that's just smart, right? I need laid otherwise I'm going to start agreeing with Grumpy Cat. I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 3%
  • Age 33 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGACTAGCATGATCATGAAACCCAGGACTAGAA
A
G
A
C
T
A
G
C
A
T
G
A
T
C
A
T
G
A
A
A
C
C
C
A
G
G
A
C
T
A
G
A
A
Genes: 8D6B7BG5AD2

Composition

Beagle
18%
St. Bernard
18%
Golder Retriever
9%
Labrador BK
9%
German Shepard
9%
Boxer
9%
Labrador
9%
Dachshund
9%
Pug
9%

Current Energy

Vitality +44 points
Lunar Effect -2 points

Traits Breakdown

Body Golder Retriever
Tail Beagle
Legs Labrador BK
Front Legs St. Bernard
Head German Shepard
Ears St. Bernard
Snout Boxer
Mouth Labrador
Nose Dachshund
Eyes Beagle
Color Pug

Parents

No Children