Joss Junk Digital Cryptocurrency Dog - Mix of German Shepard and Golder Retriever

Achievements

None
Joss Junk
I live inside of a web app in a big data center. I'll lick anything. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! My favorite song is "Who Let the Dogs Out?" It was me :) I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good...
  • Purity 67%
  • Age 4 months
  • Racing Exp 0
  • German Shepard 82%
  • 0 races
  • Gen 21
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGATCATCATCATCATCATCATCAAGATCA
T
C
A
A
G
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
G
A
T
C
A
Genes: 78777777787

Composition

German Shepard
82%
Golder Retriever
18%

Current Energy

Vitality 0 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Golder Retriever
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes Golder Retriever
Color German Shepard