Nana Nakita Digital Cryptocurrency Dog - Mix of French Bulldog, Shiba Inu, Yorkshire Terrier, Maltese, Dachshund, Labrador, Boxer, Golder Retriever, Beagle and Labrador BK

Achievements

None
Nana Nakita
I live inside of a web app in a big data center. I'll lick anything. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! My favorite song is "Who Let the Dogs Out?" It was me :) I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good...
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATTACGACGAACCGGACCAAACAGACTAGCA
G
T
A
T
T
A
C
G
A
C
G
A
A
C
C
G
G
A
C
C
A
A
A
C
A
G
A
C
T
A
G
C
A
Genes: EF99KA5G8D6

Composition

French Bulldog
18%
Shiba Inu
9%
Yorkshire Terrier
9%
Maltese
9%
Dachshund
9%
Labrador
9%
Boxer
9%
Golder Retriever
9%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality +9 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Yorkshire Terrier
Legs French Bulldog
Front Legs French Bulldog
Head Maltese
Ears Dachshund
Snout Labrador
Mouth Boxer
Nose Golder Retriever
Eyes Beagle
Color Labrador BK

Parents

No Children