Belt Brunhilda Bitcoin Dog - Mix of Beagle, Grey Wolf, Labrador, French Bulldog, St. Bernard, Boxer, Labrador BK and Husky

Achievements

Racer
Podium Champion
Belt Brunhilda
I'll eat my vomit and yours too. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I really enjoy heavy petting. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 4%
  • Age 31 days
  • Racing Exp 24
  • Beagle 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 1 1
 Best Time15.02 sec
No rank  Racing *** Pts
50.0 % wins (3) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CGACTACCCCCATGACTACCACCCAACGCAACA
C
G
A
C
T
A
C
C
C
C
C
A
T
G
A
C
T
A
C
C
A
C
C
C
A
A
C
G
C
A
A
C
A
Genes: 9DL5BD5LG64

Composition

Beagle
18%
Grey Wolf
18%
Labrador
18%
French Bulldog
9%
St. Bernard
9%
Boxer
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality +41 points
Lunar Effect +6 points

Traits Breakdown

Body French Bulldog
Tail Beagle
Legs Grey Wolf
Front Legs Labrador
Head St. Bernard
Ears Beagle
Snout Labrador
Mouth Grey Wolf
Nose Boxer
Eyes Labrador BK
Color Husky

Parents

Children

Photos

online pet race podium cryptocurrency dog race Litecoin canine racing podium