Admiral Allie Bitcoin Dog - Mix of Labrador, Pitbull terrier, Shiba Inu, German Shepard, Dachshund, Rottweiler, Poodle, French Bulldog, Labrador BK, Boxer and Golder Retriever

Achievements

None
Admiral Allie
I'll eat my vomit and yours too. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I really enjoy heavy petting. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCATCCGTATCAGGACACGACCGAGCAAACAGA
C
C
A
T
C
C
G
T
A
T
C
A
G
G
A
C
A
C
G
A
C
C
G
A
G
C
A
A
A
C
A
G
A
Genes: 5NE7AHI96G8

Composition

Labrador
9%
Pitbull terrier
9%
Shiba Inu
9%
German Shepard
9%
Dachshund
9%
Rottweiler
9%
Poodle
9%
French Bulldog
9%
Labrador BK
9%
Boxer
9%
Golder Retriever
9%

Current Energy

Vitality -20 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Pitbull terrier
Legs Shiba Inu
Front Legs German Shepard
Head Dachshund
Ears Rottweiler
Snout Poodle
Mouth French Bulldog
Nose Labrador BK
Eyes Boxer
Color Golder Retriever