Iggy Isadora Litecoin Dog - Mix of Rottweiler, Boxer, German Shepard, Schnauzer, Pug, Yorkshire Terrier, Grey Wolf, Labrador BK, Maltese, Beagle and Dachshund

Achievements

None
Iggy Isadora
I'm having some new data architecture built for me, then I'd like to have you over to my place. I cry whenever I hear an ambulance siren! You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. Are you into garbage cans? I am. I don't like going to the groomer. Leave my beautiful fur alone!
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACAACTCAATAGAATTACCCGCAACCCTAGGA
C
A
C
A
A
C
T
C
A
A
T
A
G
A
A
T
T
A
C
C
C
G
C
A
A
C
C
C
T
A
G
G
A
Genes: HG7C2FL6KDA

Composition

Rottweiler
9%
Boxer
9%
German Shepard
9%
Schnauzer
9%
Pug
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Labrador BK
9%
Maltese
9%
Beagle
9%
Dachshund
9%

Current Energy

Vitality -28 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Boxer
Legs German Shepard
Front Legs Schnauzer
Head Pug
Ears Yorkshire Terrier
Snout Grey Wolf
Mouth Labrador BK
Nose Maltese
Eyes Beagle
Color Dachshund