Rouge The Bat Ruthie Litecoin Dog - Mix of Maltese, Pug, German Shepard, French Bulldog, Labrador BK, Grey Wolf, Corgi, Schnauzer, Rottweiler, Poodle and Labrador

Achievements

Podium Champion
Pro Racer
Rouge The Bat Ruthie
I'm having some new data architecture built for me, then I'd like to have you over to my place. I cry whenever I hear an ambulance siren! You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. Are you into garbage cans? I am. I don't like going to the groomer. Leave my beautiful fur alone!
  • Purity 0%
  • Age 31 days
  • Racing Exp 71
  • Mixed-breed
  • 15 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 5 1 3
 Best Time15.08 sec
Rank 27  Racing *** Pts
60.0 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCGAATCACGAGCACCCAGCATACACGACCCA
A
C
C
G
A
A
T
C
A
C
G
A
G
C
A
C
C
C
A
G
C
A
T
A
C
A
C
G
A
C
C
C
A
Genes: K2796LOCHI5

Composition

Maltese
9%
Pug
9%
German Shepard
9%
French Bulldog
9%
Labrador BK
9%
Grey Wolf
9%
Corgi
9%
Schnauzer
9%
Rottweiler
9%
Poodle
9%
Labrador
9%

Current Energy

Vitality +1 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Pug
Legs German Shepard
Front Legs French Bulldog
Head Labrador BK
Ears Grey Wolf
Snout Corgi
Mouth Schnauzer
Nose Rottweiler
Eyes Poodle
Color Labrador