Lovey Lincoln Litecoin Dog - Mix of Husky, Schnauzer, Labrador BK, Pug, Border Collie, Rottweiler, Dachshund, Shiba Inu and Boxer

Achievements

Racer
Lovey Lincoln
Let me introduce myself, I'm Lovey Lincoln. I live inside of a web app in a big data center. Oh, go ahead. Pet me. I know you want to. I like to work out by digging fresh holes in landscaped yards. My favorite game is Fetch except I never bring the ball back.
  • Purity 5%
  • Age 39 months
  • Racing Exp 6
  • Husky 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.42 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGCAGAATACATACACATAGGAGTAAACACA
A
C
A
G
C
A
G
A
A
T
A
C
A
T
A
C
A
C
A
T
A
G
G
A
G
T
A
A
A
C
A
C
A
Genes: 462JCHCAEG4

Composition

Husky
18%
Schnauzer
18%
Labrador BK
9%
Pug
9%
Border Collie
9%
Rottweiler
9%
Dachshund
9%
Shiba Inu
9%
Boxer
9%

Current Energy

Vitality -33 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Labrador BK
Legs Pug
Front Legs Border Collie
Head Schnauzer
Ears Rottweiler
Snout Schnauzer
Mouth Dachshund
Nose Shiba Inu
Eyes Boxer
Color Husky