Bishop Banjo Hitter Digital Cryptocurrency Game Dog - Mix of Rottweiler, Labrador BK, Shiba Inu and Yorkshire Terrier

Achievements

None
Bishop Banjo Hitter
Hey, good-looking! This is Bishop Banjo Hitter. I cry whenever I hear an ambulance siren! My favorite place to sleep is under the covers between my humans. I enjoy staying active, and running circles around puppies and young children. My human is my best friend, looking for someone who is okay with that.
  • Purity 52%
  • Age 15 months
  • Racing Exp 0
  • Rottweiler 73%
  • 0 races
  • Gen 5
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACCACCACCACCACGCACACCACGTATTA
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
G
C
A
C
A
C
C
A
C
G
T
A
T
T
A
Genes: HHHHHH6HHEF

Composition

Rottweiler
73%
Labrador BK
9%
Shiba Inu
9%
Yorkshire Terrier
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Labrador BK
Mouth Rottweiler
Nose Rottweiler
Eyes Shiba Inu
Color Yorkshire Terrier