Kirby Kerry Digital Cryptocurrency Game Dog - Mix of Labrador, Dachshund, Poodle, Yorkshire Terrier, Grey Wolf, Labrador BK, Pitbull terrier, Shiba Inu and Beagle

Achievements

None
Kirby Kerry
Hey, good-looking! This is Kirby Kerry. I cry whenever I hear an ambulance siren! My favorite place to sleep is under the covers between my humans. I enjoy staying active, and running circles around puppies and young children. My human is my best friend, looking for someone who is okay with that.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGACTTACCCGCATCCGTACCAGGACTAGGA
C
C
A
G
A
C
T
T
A
C
C
C
G
C
A
T
C
C
G
T
A
C
C
A
G
G
A
C
T
A
G
G
A
Genes: 5IFL6NE5ADA

Composition

Labrador
18%
Dachshund
18%
Poodle
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Labrador BK
9%
Pitbull terrier
9%
Shiba Inu
9%
Beagle
9%

Current Energy

Vitality +36 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador
Tail Poodle
Legs Yorkshire Terrier
Front Legs Grey Wolf
Head Labrador BK
Ears Pitbull terrier
Snout Shiba Inu
Mouth Labrador
Nose Dachshund
Eyes Beagle
Color Dachshund

Parents

No Children