Tiny Turbo Crypto Game Dog - Mix of Beagle, Husky, Maltese, Schnauzer, St. Bernard, Shiba Inu, Labrador BK, Poodle and Boxer

Achievements

None
Tiny Turbo
What's up, dog? I'm Tiny Turbo! My AI may be artificial, but at least I'm intelligent. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! If I can't reach it to clean it myself, it doesn't need cleaning! My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 5%
  • Age 33 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAACCATATGAGTAGCAGACAACCTAACAACA
C
T
A
A
C
C
A
T
A
T
G
A
G
T
A
G
C
A
G
A
C
A
A
C
C
T
A
A
C
A
A
C
A
Genes: DKCBE6IGD44

Composition

Beagle
18%
Husky
18%
Maltese
9%
Schnauzer
9%
St. Bernard
9%
Shiba Inu
9%
Labrador BK
9%
Poodle
9%
Boxer
9%

Current Energy

Vitality +5 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Maltese
Legs Schnauzer
Front Legs St. Bernard
Head Shiba Inu
Ears Labrador BK
Snout Poodle
Mouth Boxer
Nose Beagle
Eyes Husky
Color Husky

Parents

No Children