Shadow Suzy Crypto Game Dog - Mix of Rottweiler, Grey Wolf, Border Collie, Labrador BK, French Bulldog, Boxer, Shiba Inu and Labrador

Achievements

None
Shadow Suzy
What's up, dog? I'm Shadow Suzy! My AI may be artificial, but at least I'm intelligent. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! If I can't reach it to clean it myself, it doesn't need cleaning! My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 6%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCCCCACCCCTACCACGCACGAAACGTACCA
C
A
C
C
C
C
C
A
C
C
C
C
T
A
C
C
A
C
G
C
A
C
G
A
A
A
C
G
T
A
C
C
A
Genes: HLHLJH69GE5

Composition

Rottweiler
27%
Grey Wolf
18%
Border Collie
9%
Labrador BK
9%
French Bulldog
9%
Boxer
9%
Shiba Inu
9%
Labrador
9%

Current Energy

Vitality 0 points
Lunar Effect -6 points

Traits Breakdown

Body Rottweiler
Tail Grey Wolf
Legs Rottweiler
Front Legs Grey Wolf
Head Border Collie
Ears Rottweiler
Snout Labrador BK
Mouth French Bulldog
Nose Boxer
Eyes Shiba Inu
Color Labrador