Guile Giselle Digital Cryptocurrency Game Dog - Mix of Pitbull terrier, Shiba Inu, Corgi, French Bulldog, Schnauzer and Boxer

Achievements

None
Guile Giselle
I'm a super-dog in the internet universe. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 25%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 55%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGTATCCTCCAGCTCCCGATCCATAAACTCC
T
C
C
G
T
A
T
C
C
T
C
C
A
G
C
T
C
C
C
G
A
T
C
C
A
T
A
A
A
C
T
C
C
Genes: NENNON9NCGN

Composition

Pitbull terrier
55%
Shiba Inu
9%
Corgi
9%
French Bulldog
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality -41 points
Lunar Effect +4 points

Traits Breakdown

Body Pitbull terrier
Tail Shiba Inu
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Corgi
Ears Pitbull terrier
Snout French Bulldog
Mouth Pitbull terrier
Nose Schnauzer
Eyes Boxer
Color Pitbull terrier