Bitsy Black-Jack Digital Cryptocurrency Game Dog - Mix of Maltese, Rottweiler, German Shepard, Grey Wolf, Border Collie, St. Bernard, Golder Retriever, Yorkshire Terrier, French Bulldog and Pug

Achievements

None
Bitsy Black-Jack
I'm a super-dog in the internet universe. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 1%
  • Age 32 days
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCCACTCACCCTACTGAACCAGATTACGAGAA
A
C
C
C
A
C
T
C
A
C
C
C
T
A
C
T
G
A
A
C
C
A
G
A
T
T
A
C
G
A
G
A
A
Genes: KH7LJBK8F92

Composition

Maltese
18%
Rottweiler
9%
German Shepard
9%
Grey Wolf
9%
Border Collie
9%
St. Bernard
9%
Golder Retriever
9%
Yorkshire Terrier
9%
French Bulldog
9%
Pug
9%

Current Energy

Vitality +46 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Rottweiler
Legs German Shepard
Front Legs Grey Wolf
Head Border Collie
Ears St. Bernard
Snout Maltese
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes French Bulldog
Color Pug

Parents

No Children