Westie Woofer Bitcoin Game Dog - Mix of Beagle, Labrador BK, Rottweiler, Golder Retriever, Labrador, Pug, Yorkshire Terrier, Shiba Inu and Border Collie

Achievements

Racer
Westie Woofer
Howdy there. I'm Westie Woofer. I make the best virtual pet. Steak is my absolute favorite, but I prefer to eat chicken for my health. I love cuddling up, doggy-style after a romantic evening. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 3%
  • Age 39 months
  • Racing Exp 1
  • Beagle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.50 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACAGACTACCAGAATTAGCAGTATACGCACTA
C
A
C
A
G
A
C
T
A
C
C
A
G
A
A
T
T
A
G
C
A
G
T
A
T
A
C
G
C
A
C
T
A
Genes: H8D52F6EJ6D

Composition

Beagle
18%
Labrador BK
18%
Rottweiler
9%
Golder Retriever
9%
Labrador
9%
Pug
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality -38 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Golder Retriever
Legs Beagle
Front Legs Labrador
Head Pug
Ears Yorkshire Terrier
Snout Labrador BK
Mouth Shiba Inu
Nose Border Collie
Eyes Labrador BK
Color Beagle

Parents

No Children

Photos