Moon Miasy Crypto Game Dog - Mix of Beagle, Golder Retriever, Boxer, French Bulldog, Pug, German Shepard, Poodle and Border Collie

Achievements

Racer
Moon Miasy
If you'd like to get together, I'm Moon Miasy. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from??
  • Purity 6%
  • Age 39 months
  • Racing Exp 1
  • Beagle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time17.63 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGACTAGAATCAGACAGACTATACAACAACAGA
C
G
A
C
T
A
G
A
A
T
C
A
G
A
C
A
G
A
C
T
A
T
A
C
A
A
C
A
A
C
A
G
A
Genes: 9D27I8DJGG8

Composition

Beagle
18%
Golder Retriever
18%
Boxer
18%
French Bulldog
9%
Pug
9%
German Shepard
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -47 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Beagle
Legs Pug
Front Legs German Shepard
Head Poodle
Ears Golder Retriever
Snout Beagle
Mouth Border Collie
Nose Boxer
Eyes Boxer
Color Golder Retriever

Parents

Children

Photos