Siri Smarty Bitcoin Game Dog - Mix of St. Bernard, French Bulldog, Border Collie, Poodle, Grey Wolf, Yorkshire Terrier, Pug, Dachshund, Shiba Inu, Boxer and Golder Retriever

Achievements

Racer
Podium Champion
Siri Smarty
Yo dog! Siri Smarty here. I hate having to wear foo-foo clothes and ribbons in my fur. I think hamsters and cats are both over-rated. Chasing anything that will run is so much fun, I could do that all day. I like it when you're frisky.
  • Purity 0%
  • Age 39 months
  • Racing Exp 68
  • Mixed-breed
  • 20 races
  • Gen 0
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 2 4 2
 Best Time15.13 sec
Rank 15  Racing *** Pts
40.0 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGACGATACGACCCCTTAGAAGGAGTAAACAGA
T
G
A
C
G
A
T
A
C
G
A
C
C
C
C
T
T
A
G
A
A
G
G
A
G
T
A
A
A
C
A
G
A
Genes: B9JILF2AEG8

Composition

St. Bernard
9%
French Bulldog
9%
Border Collie
9%
Poodle
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Pug
9%
Dachshund
9%
Shiba Inu
9%
Boxer
9%
Golder Retriever
9%

Current Energy

Vitality -37 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail French Bulldog
Legs Border Collie
Front Legs Poodle
Head Grey Wolf
Ears Yorkshire Terrier
Snout Pug
Mouth Dachshund
Nose Shiba Inu
Eyes Boxer
Color Golder Retriever

Parents

Children

Photos

Bitcoin dog race results online dog race cryptocurrency canine race photo Litecoin pet race podium Litecoin pet racing podium cryptocurrency pet racing cryptocurrency doggy racing virtual doggy race results