Miss Kitty Melody Bitcoin Dog - Mix of Grey Wolf, Husky, Pug, Corgi, German Shepard and Labrador BK

Achievements

None
Miss Kitty Melody
I'd like to take you for a byte to eat in cyberspace. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Power outages and computer viruses scare me! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 13%
  • Age 41 months
  • Racing Exp 0
  • Grey Wolf 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACACCCAGCTCACCCGAACCCGCACCCGAA
A
C
A
A
C
A
C
C
C
A
G
C
T
C
A
C
C
C
G
A
A
C
C
C
G
C
A
C
C
C
G
A
A
Genes: 44LO7L2L6L2

Composition

Grey Wolf
36%
Husky
18%
Pug
18%
Corgi
9%
German Shepard
9%
Labrador BK
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Grey Wolf
Front Legs Corgi
Head German Shepard
Ears Grey Wolf
Snout Pug
Mouth Grey Wolf
Nose Labrador BK
Eyes Grey Wolf
Color Pug