Cyber Conan Crypto Dog - Mix of Dachshund, Pitbull terrier, French Bulldog, Schnauzer, Husky, Grey Wolf, Golder Retriever, Corgi, Poodle and Maltese

Achievements

Podium Champion
Pro Racer
Master Champion
TOP 10 Fastest
Cyber Conan
I don't understand why my human tries to give me tap water. I expect filtered and distilled! My humans say I slobber too much, but hey, I'm just juicy. When I can break free, I enjoy exploring my neighborhood without my human. If I had to pick a favorite food it would be a hot-dog, because you are what you eat!
  • Purity 1%
  • Age 5 months
  • Racing Exp 122
  • Dachshund 18%
  • 26 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 4 8 4
 Best Time14.70 sec
Rank 6  Racing *** Pts
61.5 % wins (16) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATCCCGAATAACAGGACCCAGAAGCGACACC
G
G
A
T
C
C
C
G
A
A
T
A
A
C
A
G
G
A
C
C
C
A
G
A
A
G
C
G
A
C
A
C
C
Genes: AN9C4AL8OIK

Composition

Dachshund
18%
Pitbull terrier
9%
French Bulldog
9%
Schnauzer
9%
Husky
9%
Grey Wolf
9%
Golder Retriever
9%
Corgi
9%
Poodle
9%
Maltese
9%

Current Energy

Vitality -40 points
Lunar Effect -18 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs French Bulldog
Front Legs Schnauzer
Head Husky
Ears Dachshund
Snout Grey Wolf
Mouth Golder Retriever
Nose Corgi
Eyes Poodle
Color Maltese