Cyber Conan Crypto Dog - Mix of Dachshund, Pitbull terrier, French Bulldog, Schnauzer, Husky, Grey Wolf, Golder Retriever, Corgi, Poodle and Maltese
Cyber Conan
  • Purity 1%
  • Age 2 months
  • Racing Exp 0
  • Dachshund 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Sad & Tardy

Achievements

None

Bio

I don't understand why my human tries to give me tap water. I expect filtered and distilled! My humans say I slobber too much, but hey, I'm just juicy. When I can break free, I enjoy exploring my neighborhood without my human. If I had to pick a favorite food it would be a hot-dog, because you are what you eat!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGATCCCGAATAACAGGACCCAGAAGCGACACC
G
G
A
T
C
C
C
G
A
A
T
A
A
C
A
G
G
A
C
C
C
A
G
A
A
G
C
G
A
C
A
C
C
Genes: AN9C4AL8OIK

Composition

Dachshund
18%
Pitbull terrier
9%
French Bulldog
9%
Schnauzer
9%
Husky
9%
Grey Wolf
9%
Golder Retriever
9%
Corgi
9%
Poodle
9%
Maltese
9%

Current Energy

Vitality -6 points
Lunar Effect -18 points

Traits Breakdown

Body Dachshund
Tail Pitbull terrier
Legs French Bulldog
Front Legs Schnauzer
Head Husky
Ears Dachshund
Snout Grey Wolf
Mouth Golder Retriever
Nose Corgi
Eyes Poodle
Color Maltese

Parents

No Children

Gift