Amy Akita Bitcoin Dog - Mix of Corgi, Golder Retriever, Pug, French Bulldog, Husky, St. Bernard, Border Collie, Maltese and Yorkshire Terrier

Achievements

Racer
Amy Akita
I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! My human's feet are definitely the greatest smell ever. Especially after a long day at work! I like big butts, I cannot lie. Sometimes I forget where I buried my bone.
  • Purity 3%
  • Age 42 months
  • Racing Exp 18
  • Corgi 18%
  • 12 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
12 races    Best Time14.88 sec
No rank  Racing *** Coins
8.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAACGAAGCAGAACATGAAGCTACACCAGATTA
G
A
A
C
G
A
A
G
C
A
G
A
A
C
A
T
G
A
A
G
C
T
A
C
A
C
C
A
G
A
T
T
A
Genes: 29O84BOJK8F

Composition

Corgi
18%
Golder Retriever
18%
Pug
9%
French Bulldog
9%
Husky
9%
St. Bernard
9%
Border Collie
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -34 points
Lunar Effect -2 points

Traits Breakdown

Body Pug
Tail French Bulldog
Legs Corgi
Front Legs Golder Retriever
Head Husky
Ears St. Bernard
Snout Corgi
Mouth Border Collie
Nose Maltese
Eyes Golder Retriever
Color Yorkshire Terrier