Zippy Zinger Crypto Game Dog - Mix of Poodle, Pug, Maltese, Golder Retriever, Labrador BK, Labrador, St. Bernard, Grey Wolf and Schnauzer

Achievements

Racer
Podium Champion
Zippy Zinger
Hey, good-looking! This is Zippy Zinger. The Ethernet where I live, rocks. I think hamsters and cats are both over-rated. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 3%
  • Age 39 months
  • Racing Exp 57
  • Poodle 18%
  • 16 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 2 2 3
 Best Time15.15 sec
Rank 25  Racing *** Pts
43.8 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCAGAGCACCATGAGACGAACCCATAGACGAA
A
C
C
A
G
A
G
C
A
C
C
A
T
G
A
G
A
C
G
A
A
C
C
C
A
T
A
G
A
C
G
A
A
Genes: K865BI2LCI2

Composition

Poodle
18%
Pug
18%
Maltese
9%
Golder Retriever
9%
Labrador BK
9%
Labrador
9%
St. Bernard
9%
Grey Wolf
9%
Schnauzer
9%

Current Energy

Vitality -31 points
Lunar Effect -6 points

Traits Breakdown

Body Maltese
Tail Golder Retriever
Legs Labrador BK
Front Legs Labrador
Head St. Bernard
Ears Poodle
Snout Pug
Mouth Grey Wolf
Nose Schnauzer
Eyes Poodle
Color Pug