Nutmeg Nike Litecoin Game Dog - Mix of Golder Retriever, Yorkshire Terrier, German Shepard, Labrador BK, Boxer, Pitbull terrier and Dachshund

Achievements

Racer
Podium Champion
Nutmeg Nike
I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! The place I like most in the world is curled up in my human's bed, hogging all the covers! Aggressive dogs that don't let 'me be me' frustrate me. Looking for that special tail wag.
  • Purity 9%
  • Age 39 months
  • Racing Exp 30
  • Golder Retriever 27%
  • 12 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

12 races   |
  • 1 1 1
 Best Time15.75 sec
No rank  Racing *** Pts
25.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATCATTATCAGCAAACAGATCCAGAAGAGGA
T
T
A
T
C
A
T
T
A
T
C
A
G
C
A
A
A
C
A
G
A
T
C
C
A
G
A
A
G
A
G
G
A
Genes: F7F76G8N88A

Composition

Golder Retriever
27%
Yorkshire Terrier
18%
German Shepard
18%
Labrador BK
9%
Boxer
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -37 points
Lunar Effect -2 points

Traits Breakdown

Body Yorkshire Terrier
Tail German Shepard
Legs Yorkshire Terrier
Front Legs German Shepard
Head Labrador BK
Ears Boxer
Snout Golder Retriever
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Golder Retriever
Color Dachshund