Meeko Moon Digital Cryptocurrency Dog - Mix of Maltese, German Shepard, Shiba Inu, Husky, Pitbull terrier, Dachshund, Corgi, Schnauzer, Golder Retriever, Labrador and Grey Wolf

Achievements

Racer
Meeko Moon
Hello, there. Meeko Moon here. I'd like to take you for a byte to eat in cyberspace. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Air Bud is definitely my favorite movie. What a role model! I've had my nose rubbed in 'it' more than once.
  • Purity 0%
  • Age 41 months
  • Racing Exp 24
  • Mixed-breed
  • 6 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 3 0
6 races    Best Time16.22 sec
Rank 91  Racing *** Coins
50.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCTCAGTAACATCCGGAAGCATAAGACCACCC
A
C
C
T
C
A
G
T
A
A
C
A
T
C
C
G
G
A
A
G
C
A
T
A
A
G
A
C
C
A
C
C
C
Genes: K7E4NAOC85L

Composition

Maltese
9%
German Shepard
9%
Shiba Inu
9%
Husky
9%
Pitbull terrier
9%
Dachshund
9%
Corgi
9%
Schnauzer
9%
Golder Retriever
9%
Labrador
9%
Grey Wolf
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs Shiba Inu
Front Legs Husky
Head Pitbull terrier
Ears Dachshund
Snout Corgi
Mouth Schnauzer
Nose Golder Retriever
Eyes Labrador
Color Grey Wolf