Bilbo Breeze Crypto Dog - Mix of Husky, German Shepard, Grey Wolf, Rottweiler, French Bulldog, Corgi, Schnauzer, Poodle and Maltese

Achievements

Racer
Bilbo Breeze
I've been known to take mega bytes when playing ruff. Halloween costumes are the worst, I hate 'em! I love fetching anything my human throws! My favorite place in the world is the dog park. So many smells! If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 5%
  • Age 39 months
  • Racing Exp 20
  • Husky 18%
  • 10 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

10 races   |
  • 0 0 2
 Best Time15.37 sec
Rank 43  Racing *** Pts
20.0 % wins (2) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: ACATCACCCTCACACCGAAGCATAGACACCACA
A
C
A
T
C
A
C
C
C
T
C
A
C
A
C
C
G
A
A
G
C
A
T
A
G
A
C
A
C
C
A
C
A
Genes: 47L7H9OCIK4

Composition

Husky
18%
German Shepard
18%
Grey Wolf
9%
Rottweiler
9%
French Bulldog
9%
Corgi
9%
Schnauzer
9%
Poodle
9%
Maltese
9%

Current Energy

Vitality -11 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Grey Wolf
Front Legs German Shepard
Head Rottweiler
Ears French Bulldog
Snout Corgi
Mouth Schnauzer
Nose Poodle
Eyes Maltese
Color Husky

Parents

No Children

Photos

crypto dog racing crypto canine race