Spencer Sherman Digital Cryptocurrency Dog - Mix of Border Collie, Grey Wolf, Maltese, Corgi, French Bulldog, Golder Retriever, Boxer, Labrador and Pug

Achievements

Racer
Spencer Sherman
Yo! I'm Spencer Sherman and I'd like to rock your world. Someday I'm gonna breakout from inside this server. Hound Dog by Elvis is probably the best song ever written. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm just looking for some puppy love.
  • Purity 3%
  • Age 21 months
  • Racing Exp 3
  • Border Collie 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
3 races    Best Time16.63 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCAGCCGATACAGAAACCCCCCATACGAACCC
A
C
C
A
G
C
C
G
A
T
A
C
A
G
A
A
A
C
C
C
C
C
C
A
T
A
C
G
A
A
C
C
C
Genes: KO9J8GL5J2L

Composition

Border Collie
18%
Grey Wolf
18%
Maltese
9%
Corgi
9%
French Bulldog
9%
Golder Retriever
9%
Boxer
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -54 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Corgi
Legs French Bulldog
Front Legs Border Collie
Head Golder Retriever
Ears Boxer
Snout Grey Wolf
Mouth Labrador
Nose Border Collie
Eyes Pug
Color Grey Wolf