Spencer Sherman Digital Cryptocurrency Dog - Mix of Border Collie, Grey Wolf, Maltese, Corgi, French Bulldog, Golder Retriever, Boxer, Labrador and Pug
Spencer Sherman
  • Purity 3%
  • Age 44 months
  • Racing Exp 44
  • Border Collie 18%
  • Gold medal 3 Silver medal 2 Bronze medal 0
  • 11 races
  • Gen 0
Depressed & Snaillike

Achievements

Pro Racer

Bio

Yo! I'm Spencer Sherman and I'd like to rock your world. Someday I'm gonna breakout from inside this server. Hound Dog by Elvis is probably the best song ever written. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm just looking for some puppy love.

Racing Stats

Ran 11 races
  • 3 2 0
 Best Time16.23 sec
Rank 62  RacingĀ *** Pts
45.5% wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACCAGCCGATACAGAAACCCCCCATACGAACCC
A
C
C
A
G
C
C
G
A
T
A
C
A
G
A
A
A
C
C
C
C
C
C
A
T
A
C
G
A
A
C
C
C
Genes: KO9J8GL5J2L

Composition

Border Collie
18%
Grey Wolf
18%
Maltese
9%
Corgi
9%
French Bulldog
9%
Golder Retriever
9%
Boxer
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -54 points
Lunar Effect -10 points

Traits Breakdown

Body Maltese
Tail Corgi
Legs French Bulldog
Front Legs Border Collie
Head Golder Retriever
Ears Boxer
Snout Grey Wolf
Mouth Labrador
Nose Border Collie
Eyes Pug
Color Grey Wolf

Parents

No Children

Photos

online doggy race photo virtual pet racing Bitcoin doggy racing online canine race photo crypto dog race
Gift