Glass Joe Gumdrop Bitcoin Dog - Mix of German Shepard, Schnauzer, Shiba Inu, Dachshund, Husky, Maltese, Golder Retriever and St. Bernard

Achievements

None
Glass Joe Gumdrop
Suh...you good? Glass Joe Gumdrop here. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.
  • Purity 8%
  • Age 42 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
Rank 80  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGGAACATCATCAACCATAAGAATATCATGA
G
T
A
G
G
A
A
C
A
T
C
A
T
C
A
A
C
C
A
T
A
A
G
A
A
T
A
T
C
A
T
G
A
Genes: EA477KC8C7B

Composition

German Shepard
27%
Schnauzer
18%
Shiba Inu
9%
Dachshund
9%
Husky
9%
Maltese
9%
Golder Retriever
9%
St. Bernard
9%

Current Energy

Vitality -20 points
Lunar Effect +6 points

Traits Breakdown

Body Shiba Inu
Tail Dachshund
Legs Husky
Front Legs German Shepard
Head German Shepard
Ears Maltese
Snout Schnauzer
Mouth Golder Retriever
Nose Schnauzer
Eyes German Shepard
Color St. Bernard